Effects of strong promoters on the plasmid replication and SP6 promoter study = 강한 전사촉진제가 플라스미드 복제에 미치는 영향과 SP6 전사촉진제의 연구

Cited 0 time in webofscience Cited 0 time in scopus
  • Hit : 222
  • Download : 0
Strong T7 promoters are lethal to E. coli cells in the presence of large amounts of T7 RNA polymerase. The combination of SP6 promoter-SP6 RNA polymerase is also stressful to E. coli cells. The instability of strong promoter-RNA polymerase combination is said to be the effect of a NTP sink. However it can be also explained by plasmid loss due to inhibition of plasmid replication. Promoters oriented in the opposite direction of replication origin of ColEl-type plasmid, reduce the copy numbers of the plasmid in the presence of appropriate RNA polymerase. However a transcription termination signal relieves the copy number reduction, probably, by inhibiting the production of long RNA transcripts containing RNA I sequence at the 3`` end. Copy number of pGEM4Z which containing a SP6 promoter against ori was reduced to 80, and pGEM4ZS with a terminator down-stream the SP6 promoter was reduced to 290 in E. coli JM109 (pACSP6R) from 400. SP6 promoter has consensus sequence of ATTTAGGTGACACTATAGAAGA from -17 to +5. It is suggested that the region from -17 to -4 is binding domain and -3 to +5 is initiation domain. The importance of several positions was determined by cloning of randomly mutated SP6 promoter. The single point mutations, a G to A substitution at -11 and a T to C at -2 significantly reduced the the promoter activity to 15%. The single substitution of a T to G at -14 and -4, and a G to T at +1 also lead to the reduction of promoter activity to 21-22%. The single base substitutions of a A to T at -8, a C to T at -7, a T to A at -2 and a C to A at -5 retained about half of the promoter activity. The hierarchy of importance was partially determined as -11, -2 > -14, -4, +1 > -8, -7, -5, -9 > -12, -10.
Advisors
Kang, Chang-Wonresearcher강창원researcher
Description
한국과학기술원 : 생명과학과,
Publisher
한국과학기술원
Issue Date
1995
Identifier
98686/325007 / 000933128
Language
eng
Description

학위논문(석사) - 한국과학기술원 : 생명과학과, 1995.2, [ iv, 39 p. ]

URI
http://hdl.handle.net/10203/28436
Link
http://library.kaist.ac.kr/search/detail/view.do?bibCtrlNo=98686&flag=dissertation
Appears in Collection
BS-Theses_Master(석사논문)
Files in This Item
There are no files associated with this item.

qr_code

  • mendeley

    citeulike


rss_1.0 rss_2.0 atom_1.0