Structure and nucleotide sequence of canine gastrin gene

Abstract

The nucleotide sequence of the full length canine gastrin gene and its flanking regions were determined. The 2.3-kb gene consists of three exons and two introns. The 300 bp upstream flanking region sequence reveals some transcription regulatory sequences. Also the 450 bp downstream sequence reveals a putative transcription terminator sequence. The 1.7 kb intron I, about half the size of human intron I, is located in the 5`` untranslated region and the 117 bp intron II interrupts the aspartic acid codon at position 71 of preprogastrin. All the intron-exon junctions contain the consensus sequences of the 5`` and 3`` ends of eucaryotic introns, 5`` GT and AG 3`` respectively. A putative transcription initiation site is assigned to the adenine at 64 bp upstream from the first exon-inron junction on the basis of sequence comparison of human and canine gastrin promoters. A possible ``TATA`` equivalent sequence TTATAA is located at 28 bp upstream from the putative cap site. However, ``CAAT`` box equivalent sequence is not found in either orientation. A ploy(A) addition signal, AAUAAA, is located at 62 base pairs downstream from the termination codon UAG. The 5`` regulatory sequence also contains Ap-1 and Ap-2 binding sites, which suggests transcription regulation by these transcription factors. A putative terminator, TTTTTAATATTTTACTTATTTATTTATTT, which resembles the human terminator sequence TTTTTTTTTAATTTTTATTTTATTTTATTTT is located at approximately 160 bp downstream of the ploy(A) addition site. It has a 6.5 bp inverted repeat sequence unlike the 10.5 bp inverted repeat symmetry of human gastrin terminator.